Categories Anthropology

I. 9.2 Mendelian genetics in man-family study, single factor, multifactor, lethal, sub-lethal and polygenic inheritance in man.

Monogenetic disorder

It is caused by changes or mutations that occur in the DNA sequence of a single
gene, also called Mendelian disorder. There are more than 6,000 known single-
gene disorders, which occur in about 1 out of every 200 births. Some examples
of monogenetic disorders include: Cystic Fibrosis, Sickle Cell Anaemia, Marfan
syndrome, Huntington’s disease, and Hemochromatosis. Single-gene disorders
are inherited in recognisable patterns: autosomal dominant, autosomal recessive,
and X-linked.

Example: Sickle cell anaemia is a disease passed down through families in which
red blood cells form an abnormal crescent shape (Red blood cells are normally
shaped like a disc.) Sickle cell anaemia is caused by an abnormal type of
haemoglobin called haemoglobin S. Haemoglobin is a protein inside red blood
cells that carries oxygen. Haemoglobin S changes the shape of red blood cells,
especially when the cells are exposed to low oxygen levels. Then the red blood
cells become crescent shaped or sickles. The sickling occurs because of a mutation
in the haemoglobin gene. The haemoglobin beta(HBB) gene is found in region
15.5 on the short (p) arm of human chromosome 11. In sickle cell haemoglobin
(HbS) the glutamic acid in position 6 is mutated to valine in a beta chain. This
change allows the deoxygenated form of the haemoglobin to stick to itself and
become crescent shape.

The fragile, sickle shaped cells deliver less oxygen to the body’s tissues. They
can also get stuck more easily in small blood vessels, and break into pieces that
interrupt healthy blood flow.

Sickle cell anaemia is inherited from both parents. If you inherit the haemoglobin
S gene from one parent and normal haemoglobin (A) from your other parent,
you will have sickle cell trait. People with sickle cell trait do not have the
symptoms of sickle cell anaemia. The children of both sickle cell parents will
get sickle cell anaemia.

Sickle cell disease is much more common in people of African and Mediterranean
descent. It is also seen in people from South and Central America, the Caribbean,
and the Middle East.

  • Multifactorial Disease

It is called complex or polygenic disease. Complex diseases are caused by a
interaction of environmental factors and mutations in multiple genes. Some
common chronic diseases are multifactorial in nature. Examples of complex
diseases include: Cardio Vascular diseases, high blood pressure, Alzheimer’s
disease, arthritis, diabetes, cancer, and obesity. For example, different genes that
influence breast cancer susceptibility have been found on chromosomes 6, 11,
13, 14, 15, 17, and 22.

Mutations in BRCA1 gene (BRCA1 Gene is located on chromosome 17q21.31)
contribute significantly to the development of familial/hereditary breast and
ovarian cancer. Founder mutations such as the BRCAl-185delAG and 5382insC
are found among Ashkenazi Jews.

Polymorphism in BRCA1 Chr 17 at np 37043496

CCGCCCCTACCCCCCGTCAAAGAATACCCAT(normal form)
CCGCCCCTACCCCCCCTCAAAGAATACCCAT (mutated form)

Large rearrangements, mostly deletions in regions of Y-specific genes (AZFa,
AZFb, AZFc), have been known as causes for many diseases leading to male
infertility, causing spermatogenic failure, azoospermia, severe oligo spermia or
otherwise severely impair male reproductive fitness.

Lethal gene: Gene which causes death of individual in early stage when it comes in homozygous condition called lethal gene. Lethal gane may be dominant or recessive both.

Semilethal gene: Many of these genes which do not cause definite lethelity are called semilethals.In semilethal gene death occurs in late stage.

Lethal gene was discovered by L.Cuenot in coat colour of mice, Yellow body colour (Y) was dominant over brown colour (y). Gene of yellow body colour is lethal. So homozygous yellow mice are never obtained in population. It dies in embryonal stage

Polygenic Inheritance : Inheritance of characters in which one character is controlled by many genes and intensity of character depends upon the number of dominant allele or gene. Polygenic inheritance first described by Nilsson – Ehle in kernal colour of wheat.

Example – Colour of the skin in Human. The inheritance of colour of skin in human studied by Devenport. When Negro (AA BB) phenotype crossed with white (aa bb) phenotype, intermediate phenotype produced in F1 generation.

 

Leave a Reply